1 surgery for congenital heart disease

Báo cáo sinh học: "Association between neuroserpin and molecular markers of brain damage in patients with acute ischemic stroke" pot

Báo cáo sinh học: "Association between neuroserpin and molecular markers of brain damage in patients with acute ischemic stroke" pot

Ngày tải lên : 18/06/2014, 19:20
... MannWhitney test was used for continuous variables with non-Normal distribution, Student’s t test for continuous variables with Normal distribution and Chi-square test for proportions between patients ... diseases (n = 5), severe hepatic (n = 4), renal (n = 2) or hematological diseases (n = 2), cancer (n = 4) or infectious disease in the 15 days prior to inclusion (n = 5) were excluded due to their ... determined using GE Healthcare and Biohit Plc ELISA kits, respectively For neuroserpin quantification, a sandwich ELISA was performed as described previously [6,9,10] Each sample was assayed in duplicate...
  • 7
  • 541
  • 0
báo cáo hóa học:" Association between neuroserpin and molecular markers of brain damage in patients with acute ischemic stroke" pdf

báo cáo hóa học:" Association between neuroserpin and molecular markers of brain damage in patients with acute ischemic stroke" pdf

Ngày tải lên : 20/06/2014, 03:20
... MannWhitney test was used for continuous variables with non-Normal distribution, Student’s t test for continuous variables with Normal distribution and Chi-square test for proportions between patients ... diseases (n = 5), severe hepatic (n = 4), renal (n = 2) or hematological diseases (n = 2), cancer (n = 4) or infectious disease in the 15 days prior to inclusion (n = 5) were excluded due to their ... determined using GE Healthcare and Biohit Plc ELISA kits, respectively For neuroserpin quantification, a sandwich ELISA was performed as described previously [6,9,10] Each sample was assayed in duplicate...
  • 7
  • 404
  • 0
Báo cáo khoa học: "Biological markers of lung injury before and after the institution of positive pressure ventilation in patients with acute lung injury" potx

Báo cáo khoa học: "Biological markers of lung injury before and after the institution of positive pressure ventilation in patients with acute lung injury" potx

Ngày tải lên : 13/08/2014, 03:20
... Station, TX, USA) The values for the cytokine concentrations for IL-6, IL-8, and ICAM-1 were not normally distributed; therefore, we carried out natural log transformation to achieve normal distribution ... the study GC performed data acquisition GC and SB performed the immunoassays MC and MAM performed the data analysis and interpretation and drafted the manuscript MC and AS performed the statistical ... lung disease, or history of lung transplantation Clinical data collection The medical record for each patient was reviewed, and clinical data were collected using a standardised data collection form...
  • 8
  • 271
  • 0
Textbook of Traumatic Brain Injury - part 4 pdf

Textbook of Traumatic Brain Injury - part 4 pdf

Ngày tải lên : 10/08/2014, 18:20
... for the efficacy of psychotherapy For example, exposure therapy for avoidance of feared activities makes sense, but the efficacy of this approach in patients with TBI has not been established For ... incidental memory is more intact than effortful memory Therefore, the examiner may obtain more information using an open-ended design than a structured interview format, such as is required by the ... and to designate specific time frames for the initiation and discontinuation of pharmacotherapy for acute episodes and for the initiation of pharmacotherapy for chronic aggressive behavior The...
  • 64
  • 317
  • 2
Báo cáo y học: "Technical Considerations in Decompressive Craniectomy in the Treatment of Traumatic Brain Injury"

Báo cáo y học: "Technical Considerations in Decompressive Craniectomy in the Treatment of Traumatic Brain Injury"

Ngày tải lên : 25/10/2012, 11:40
... except for the technical considerations of this operation, timely decompressive craniectomy before the development of irreversible changes in the injured brain would be equally important for patient ... craniectomy/hemisphere craniectomy for lesions or swelling confined to one cerebral hemisphere, and bifrontal craniectomy for diffuse swelling, are recommended for the management of traumatic refractory ... the room that it can provide for the expansion of the brain is restricted; furthermore, this procedure may lead to temporal lobe herniation and necrosis.18 A study performed by Alexander et al demonstrated...
  • 6
  • 627
  • 0
awareness of deficit after brain injury clinical and theoretical issues jan 1991

awareness of deficit after brain injury clinical and theoretical issues jan 1991

Ngày tải lên : 11/06/2014, 09:45
... Department of Psychology University of Arizona Tucson, Arizona New York Oxford OXFORD UNIVERSITY PRESS 1991 Oxford University Press Oxford New York Toronto Delhi Bombay Calcutta Madras Karachi Petaling ... Copyright © 1991 by Oxford University Press, Inc Published by Oxford University Press, Inc., 200 Madison Avenue, New York, New York 10016 Oxford is a registered trademark of Oxford University Press ... 1988) Thus, for example, amnestic patients who lack explicit, conscious memory for recent experiences nevertheless possess intact implicit memory for various aspects of those experiences (for review,...
  • 285
  • 225
  • 0
Báo cáo hóa học: " Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury" ppt

Báo cáo hóa học: " Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury" ppt

Ngày tải lên : 19/06/2014, 08:20
... laboratory-grade force platform, which is considered the gold standard measure of balance The results suggest that the WBB could be considered as a valid portable low-cost tool for assessing standing ... their efficacy Therefore, we designed eBaViR, a virtual rehabilitation system for balance recovery that provides motivational task oriented exercises specifically designed for ABI people by clinical ... rehabilitation therapies Written informed consent was obtained from patients for publication of this case report and accompanying images A copy of the written consent is available for review by the Editor-inChief...
  • 10
  • 732
  • 0
báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf

báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf

Ngày tải lên : 19/06/2014, 08:20
... the cognitive performance of the participants in both parts of the study Written and informed consent was obtained from all participants before study enrollment The study was performed in accordance ... compared for each step Two behavioral checklists were developed based on activity analysis, a 14-item one for cash withdrawals and a 17-item one for money transfers, to assess the participants' performance ... assess performance in using ATMs and as a useful program for training clients with ABI in ATM user skills Given the popularity of internet use in Hong Kong, we provided a web-based system for VR...
  • 9
  • 454
  • 0
báo cáo hóa học: " Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice" pot

báo cáo hóa học: " Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice" pot

Ngày tải lên : 19/06/2014, 22:20
... X-100 solution for 60 at RT for permeabilization Slides were then incubated with the TdT-enzyme in reaction buffer containing fluorescein-dUTP for 90 at 37°C Negative control was performed using ... antibody and performed the zymosan assay IL, AMH, MET, and MR performed the TUNEL and immunohistochemistry experiments IL, MR and DH performed the real-time RT-PCR analyses DR and PAW performed the ... the formation of the membrane attack complex (MAC, C5b-9) through the terminal complement pathway The MAC forms through the self-association of C5b along with C6 through C9 and leads to the formation...
  • 12
  • 465
  • 0
báo cáo hóa học: " Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease" pdf

báo cáo hóa học: " Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease" pdf

Ngày tải lên : 19/06/2014, 22:20
... air pollution in cardiovascular and pulmonary disease [12], accumulating evidence now points to a new role for air pollution in CNS disease [10] For example, human studies have shown that living ... Rockford, IL) Samples were spun at 4°C 14,000 g for minutes and supernatant was collected for analysis Protein concentration was determined by the BCA protein assay (Thermo Scientific, Rockford, ... snap frozen and stored at -80C° For the current study, only one hemisphere of the brain was available for analysis Housing and experimental use of the animals were performed in strict accordance...
  • 10
  • 375
  • 0
báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc

báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc

Ngày tải lên : 19/06/2014, 22:20
... Immunostaining was performed against AQP4, ED1 and Iba1 (for macrophages and microglia), IgG (for serum protein accumulation secondary to BBB alteration) and GFAP (for astrocytes) Immunostaining For immunohistochemistry, ... AQP4 Isoform 1: NM_012825.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 213 pb 98.2% 90 pb 102.0% 778 to 796 Isoform Isoform 2: NM_001142366.1 Revs: GGTCAATGTCGATCACATGC 963 to 982 Isoform NM_017009.2 ... MR scans conducted just before sacrifice (n = 25) By introducing the repetitive MR scans that were performed before sacrifice (two to three scans per animal except for dpi, total = 49) and by...
  • 16
  • 393
  • 0
báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx

báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx

Ngày tải lên : 19/06/2014, 22:20
... Mortlake, NSW, Australia) The primers used were: for iNOS, forward: 5’-GGA CCA CCT CTA TCA GGA A-3’, and reverse: 5’-CCT CAT GAT AAC GTT TCT GGC-3’, for COX-2 forward: 5’-CTT CGG GAG CAC AAC AGA G-3’, ... reverse: 5’-GCG GAT GCC AGT GAT AGA G-3’, for TLR4, forward: 5’-AGT TGG CTC TGC CAA GTC TCA GAT- 3’, reverse: 5’-TGG CAC TCA TCA GGA TGA CAC CAT-3’, for MD-2 forward: 5’-CAT AGA ATT GCC GAA GCG CAA ... CAT CTG TGA TGG CCC TTA GGA-3’, for NFB subunit p65, forward: 5’-CAT GCG TTT CCG TTA CAA GTG CGA-3’, reverse: 5’-TGG GTG CGT CTT AGT GGT ATC TGT-3’, for IBa forward: 5’-TGG CCT TCC TCA ACT...
  • 14
  • 422
  • 0
báo cáo hóa học: " Interleukin-1alpha expression precedes IL-1beta after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues" pdf

báo cáo hóa học: " Interleukin-1alpha expression precedes IL-1beta after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues" pdf

Ngày tải lên : 19/06/2014, 22:20
... injured areas is not uniform suggesting that it is regulated Conclusions The early expression of IL-1α in areas of focal neuronal injury suggests that it is the major form of IL-1 contributing ... IL-1α-positive microglia were present in the cerebral cortex, the piriform cortex, the ventral striatum and the thalamus Immunohistochemistry for IL-1α, with cresyl violet co-staining, localized IL1α expressing ... interest for quantification of mean fluorescence intensities (MFIs) in whole microglia and microglial nuclei were selected using the GFP and DAPI signals respectively MFIs were quantified for IL-1α...
  • 16
  • 425
  • 0
Báo cáo y học: "Plasmatic B-Type Natriuretic Peptide and C-Reactive Protein in Hyperacute Stroke as Markers of Ct-Evidence of Brain Edema." pptx

Báo cáo y học: "Plasmatic B-Type Natriuretic Peptide and C-Reactive Protein in Hyperacute Stroke as Markers of Ct-Evidence of Brain Edema." pptx

Ngày tải lên : 08/08/2014, 16:23
... 6.54) For patients with ischemic stroke the baseline NIHSS was 7.6 (SD: 5.4) and 7.3 (SD: 5.1) for those with hemorrhage The mean NIHSS score for patients with edema was 11.77 (SD: 6.5) and for ... CT and, therefore, we focused only on severe edema The practice of Diffusion weighted MRI would have added important information but unfortunately this technique was unavailable for us In conclusion, ... In table are reported separately the same values for patients with edema and for those without edema The patients excluded because of congestive heart failure had very high levels of NT-PBNP (>400...
  • 6
  • 354
  • 0
Theory of Brain Function quantum mechanics and superstrings - part 4 ppt

Theory of Brain Function quantum mechanics and superstrings - part 4 ppt

Ngày tải lên : 10/08/2014, 00:21
... suggestive for a possible use of MTs as “information processors” It should be rather obvious that such a delicate, fine MT organization is there for some good reason 32 Further evidence for the ... conformational changes In the case of MTs, the programmable and adaptable nature of the tubulin conformational states can be easily used to represent and propagate information Further evidence for ... of information from one point to other in MT, by transforming the hexagonal surface organization into a new cubic state Undoubtedly, microtubule symmetry and structure are optimal for information...
  • 10
  • 247
  • 0
Traumatic brain injury and the effects of diazepam, diltiazem, and MK-801 on GABA-A receptor subunit expression in rat hippocampus ppt

Traumatic brain injury and the effects of diazepam, diltiazem, and MK-801 on GABA-A receptor subunit expression in rat hippocampus ppt

Ngày tải lên : 10/08/2014, 05:21
... difference from the value of the mean sham density for each blot, where the mean sham density was normalized at 100 Therefore, OD measurements for each band in both studies were defined in ROD ... used for time point comparisons for each subunit The results of this analysis indicated that the 24 hour post-injury time point revealed the greatest changes across the most subunits Therefore, ... first few hours after injury, therefore providing a widow of initial therapeutic sensitivity for BZ treatment post-TBI The α subunit of the GABAAR is important for postsynaptic signaling of the...
  • 11
  • 424
  • 0
Báo cáo y học: "Regional characterization of energy metabolism in the brain of normal and MPTP-intoxicated mice using new markers of glucose and phosphate transport" doc

Báo cáo y học: "Regional characterization of energy metabolism in the brain of normal and MPTP-intoxicated mice using new markers of glucose and phosphate transport" doc

Ngày tải lên : 10/08/2014, 05:21
... to the incubation with either HRBD (ligand for GLUT1), GRBD (ligand for PiT1) or AmphoΔSU (ligand for PiT2) Several fixation protocols including 4% paraformaldehyde have been evaluated 100% ethanol ... Scientific, Rockford, USA) Conditioned media were frozen at -20°C until further use Concentrated supernatants were clarified by centrifugation at 2300 g for 10 minutes at 4°C before use Animals ... and 485-535 nm emission filter for Alexa 488, 530-585 nm excitation filter and 615∞ nm emission filter for CellTrace BODIPY (intracellular membranes) Image scans for each probe were acquired in...
  • 9
  • 776
  • 1
Textbook of Traumatic Brain Injury - part 1 ppt

Textbook of Traumatic Brain Injury - part 1 ppt

Ngày tải lên : 10/08/2014, 18:20
... in age and level of hypotension are not known Information on other factors is incomplete, and data for predictive factors for moderate and mild forms of TBI are not available Estimating Brain ... with $32 billion for survivors and $16 billion for fatal brain injuries Average medical and nonmedical costs for each fatal TBI case ($450,000) were three times higher than for TBI survivors ... informed consent for the use of organs and tissues beyond diagnostic purposes, to inform patients and family about the benefits of research and medical education to society, and to provide information...
  • 62
  • 279
  • 4
Textbook of Traumatic Brain Injury - part 2 potx

Textbook of Traumatic Brain Injury - part 2 potx

Ngày tải lên : 10/08/2014, 18:20
... et al.’s (1994) original for the standard comparisons as referenced for rating pathology The Victoroff et al (1994) method for rating WM hyperintensities can be adapted for use in rating WM pathology ... performance of neuropsychological tests) Fewer studies use preand postrecovery scans, which offer the benefit of allowing for comparison in the same patients For activation studies, controlling for ... be given to studies performed with the newer “tri- FIGURE 6–1 scan Procedure for obtaining a SPECT The same scanner is used for imaging many body systems, including brain, heart, bone, and lung...
  • 66
  • 383
  • 6

Xem thêm